<< Previous Next >>

Candies for Easter?


Candies for Easter?
Photo Information
Copyright: Peter Roos (batu) Gold Star Critiquer/Gold Star Workshop Editor/Gold Note Writer [C: 1019 W: 285 N: 3404] (11270)
Genre: Animals
Medium: Color
Date Taken: 2007-08-11
Categories: Insects
Camera: Olympus E1, Zuiko Digital 35mm f/3.5-22, Macro
Exposure: f/13.0, 1/25 seconds
Photo Version: Original Version
Date Submitted: 2008-03-22 23:35
Viewed: 601
Points: 26
[Note Guidelines] Photographer's Note
Candies for Easter!
... or better ...
Eggs for Easter?

In a certain way, these small packages can be regarded as candies as they are full of nutrients and proteins - and perhaps a bit of chocolate indicated by the brown colour.
Additionally, they contain the whole wonders of life coded by one set of DNA molecules each.
The chambers, only less than 1 mm in size, are the starting point for new life ...
new life will emerge from these moth eggs artistically arranged by a Geometride female.

This is my Easter massage!

Happy Holidays, Peter


Some scientific information
Insect cells contain largely varying numbers of chromosomes dependent on the species. They can be low with n = 8 in Erebia calcaria or high as in Lycaenids with n > several hundreds (n = 23 in humans).
In the chromosomes the DNA (desoxyribonucleic acid) is structurally arranged. The long linear molecules contain the information for proteins and RNA molecules. This information has to be transcribed and translated into the latter molecules. Furthermore, the DNA contains regions which are responsible for the controlled and concerted transcription of the genes encoding the proteins and RNAs.
The whole programming is based on the linear arrangement of only four letters - A, C, G and T, occuring for example as:

... CCATGGGCTACGAACTTTAGCGCGCGCGCTATAACA ....

As the DNA is double-stranded and contains a complementary strand, the structure is:

... CCATGGGCTACGAACTTTAGCGCGCGCGAACTTGCTATAACA ...
... GGTACCCGATGCTTGAAATCGCGCGCGCTTGAACGATATTGT ...

The complementarity is defined by the formation of matching base pairs (A-T and G-C)

On one chromosome several million letters are arranged in this way. A molecular biologist can read something from this arrangements when functional entities are recognized or identified before.
For example, I implemented two control motifs in the example above: The TATAA or TATA-box can be seen as anchor structure for the transcription machinery. The GC-repeats can be used to control the binding of this machinery.
That's enough for today!
Peter
jhm, extramundi, haraprasan, JoseMiguel, flashpoint, manyee, Juyona, marcellr, oanaotilia has marked this note useful
Only registered TrekNature members may rate photo notes.
Add Critique [Critiquing Guidelines] 
Only registered TrekNature members may write critiques.
Discussions
None
You must be logged in to start a discussion.

Critiques [Translate]

  • Great 
  • jhm Gold Star Critiquer/Gold Note Writer [C: 660 W: 0 N: 178] (624)
  • [2008-03-23 0:45]

Hello Peter,

A good ode to Easter with these modern eggs, the children shall have to the eggs find in the snow here in Belgium today, very extraordinarily.
Nice presentation and soft colours.

Happy Easter,
John.

I love this one.
Anyone who has tryed to photograph insects eggs, knows that this magnification+clearness is very difficult to obtain, further more with such a beautiful composition.
Congratulations and regards, Felipe.

Hi Peter,
A nice capture of this beautiful easter eggs (insect eggs). Very well composed with good details. Thanks a lot for sharing.

Hi Peter,
It seems to be chocolates or well decorated candies!
You did a great job on this macro shot, the result is so good and interesting.
What a great dedication for this day.
Congratulations and thanks for share.
My best regards,
JM

A fine bunch of "easter eggs" handled expertly Peter, TFS my friend.
Cheers,
Mehmet

  • Great 
  • dejo Gold Star Critiquer/Gold Star Workshop Editor/Gold Note Writer [C: 355 W: 51 N: 476] (2058)
  • [2008-03-23 8:00]

Hi Peter,
fantastic work! Great composition and sharpness,
beautiful details!
TFS
Dejan

  • Great 
  • manyee Gold Star Critiquer/Gold Star Workshop Editor/Gold Note Writer [C: 3091 W: 234 N: 5896] (19880)
  • [2008-03-23 20:49]

Amazing macro, Peter!
What beautiful patterns in nature.
Your note is outstanding.
Thanks for sharing. : )
ManYee

  • Great 
  • Juyona Gold Star Critiquer/Gold Note Writer [C: 2079 W: 6 N: 2088] (13475)
  • [2008-03-24 1:54]

Hola Peter,
magnífico trabajo,
original macro, detalles y foco.
felicidades amigo,
saludos

Ciao Peter,
una foto estremamente originale, appropriata al periodo e perfettamente eseguita.
Come sempre accompagnata da una nota interessante ed istruttiva.
Ciao,
Marcello

  • Great 
  • rdfoto Gold Star Critiquer/Gold Note Writer [C: 375 W: 0 N: 747] (3202)
  • [2008-03-24 10:17]

Bonjour Peter
Très belle macro pasquale, excellente netteté et couleurs et belle lumière. Sujet très interéssant!
Amicalement Robi

  • Great 
  • Amadeo Gold Star Critiquer [C: 211 W: 0 N: 755] (3323)
  • [2008-03-24 10:37]

Hola Peter, excelente aproximación, con muy buena nitidez y luz.
Un saludo

Hi Peter,
Nice idea and "gift" for easter, ha, ha. This eggs are beautiful and tiny, you´ve made a tremendous macro shot, with the eggs filling all the image, and I like it.
Cheers
Hernán

Original y preciosa fotografía, realmente parecen huevos de Pascua o cualquier otro dulce jeje. Preciosa luz y colores.
Un saludo: J. Ignasi.

Calibration Check
















0123456789ABCDEF